Search in the Abstract Database

Search Abstracts 2011

* = Presenting author

P045. Gene expression of discs large homologue 5 gene (DLG5) in ulcerative colitis patients

J.K. Yamamoto-Furusho, E.J. Mendivil-Rangel, G. Fonseca-Camarillo, M.A. Villeda-Ramírez, R. Barreto-Zuñiga

IBD Clinic, Instituto Nacional de Ciencias Médicas y Nutrición, Mexico, Mexico

Aim: To study the DLG5 gene expression in colonic mucosa from patients with UC.

Material and Methods: We studied the DLG5 gene expression from colonic biopsies of UC patients from August 2009 to July 2010. All individuals were divided in 3 groups: (1) Active UC (n = 25); (2) Quiescent UC (n = 20); and (3) Healthy Control group (n = 20). Expression of mRNA DLG5 was measured by Real Time Polymerase Chain Reaction (RT-PCR) method. The following primers were used: DLG5 left tccagtagtgattcctgctcagt; and right: gagctccggggagagttc; GADPH left agccacatcgctcagacac and right gcccaatacgaccaaatcc for normalization. The data analysis was performed by Kruskall-Wallis and Spearman tests using the SSPS Program Version 15.0 for Windows.

Results: These results showed that DLG5 mRNA expression was increased from colonic mucosa in patients with active UC as compared to healthy control group (p < 0.0001) as well as UC in remission was up-regulated when compared to healthy control group (p < 0.0001). No significant differences were found between active and remission UC groups in the DLG5 gene expression.

Conclusion: The gene expression of DLG5 was found increased from colonic tissue in UC patients as compared to healthy individuals suggesting that over-expression of DLG5 gene could act as defence mechanism in UC patients with altered intestinal permeability.