Search in the Abstract Database

Search Abstracts 2015

* = Presenting author

P216 Defensins alpha 5 and 6 are up-regulated in the colonic mucosa from patients with Ulcerative Colitis and are associated with clinical outcomes

J. Yamamoto-Furusho*, P. Vidal-Cevallos, G. Fonseca-Camarillo

IBD Clinic, Instituto Nacional de Ciencias Medicas y Nutricion, Gastroenterology, Mexico, Mexico

Background

Ulcerative colitis (UC) is a chronic condition of unknown etiology that affects the colonic mucosa. Defensins are a family of cysteine-rich cytotoxic peptides that are found on the mucosal surface of the intestine and work as antimicrobial agents against the bacterial invasion of the intestinal epithelium. Most of the alpha defensing genes are clustered on chromosome 8, the proteins encoded by these genes (DEFA5 and 6) are highly expressed in the secretory granules of Paneth cells in the ileum. Their role has not been evaluated in patients with UC. The aim of the present study is to evaluate the expression of DEFA5 and DEFA6 genes in patients with UC.

Methods

A total of 118 individuals were included and divided into 3 groups: 1) UC active (n=43); 2) UC in remission (n=34); and 3) Control group (N=41). Total RNA was extracted from colonic mucosa biopsies, the relative expression of the DEFA5 and DEFA6 genes was determined using real time PCR. The following oligos were used, DEFA5 Left: AGGACCATCGCCATCCTT, Right:TCAGCTCTTTCCTGGAGTGAC;DEFA6 Left: CTGAGCCACTCCAAGCTGA, Right:GGGCATCAGCCTCATAAGC and GADPH Left: GCCCAATACGACCAAATCC, Right: AGCCACATCGCTCAGACAC. The statistical package SPSS v.19 was used to perform the analysis.

Results

Fifty-seven percent of the patient with UC were female. The expression of the DEFA5 gene was significantly increased in the colonic mucosa of patients with UC active compared to the control group (P=0.002) and UC in remission group (P=0.04). Furthermore a significant difference was found in the expression between the UC remission group and the control group (P=0.009). On the other hand, an up-regulation of the DEFA6 gene was also observed in the UC active group compared with the control group (P=0.0001) as well as in the remission UC group as compared to the control group (P=0.001). Finally, a significant association was found between the high expression of DEFA6 and a favorable response to medical treatment (P=0.05, RM=0.20) and the presence of histological activity (P=0.01, RM: 11.4). The DEFA5 gene was also associated with the histological activity (P=0.01, RM=11.08).

Conclusion

The expression of the DEFA5 and DEFA6 genes were increased in patients with UC, this might indicate that an underlying defense mechanism that increases the production of the antimicrobial peptides (defensins) in order to decrease the bacterial invasion in the colonic mucosa.