Search in the Abstract Database

Search Abstracts 2015

* = Presenting author

P707 Gene expression of AKAP12 in the colonic mucosa is a marker associated with disease extension in patients with Ulcerative Colitis

J. Yamamoto-Furusho*, G. Fonseca-Camarillo

IBD Clinic, Instituto Nacional de Ciencias Medicas y Nutricion, Gastroenterology, Mexico, Mexico

Background

Ulcerative colitis (UC) is a subtype of inflammatory bowel disease that affects the colonic mucosa layer. The gene of A-kinase anchor protein 12 (AKAP12) regulates cell cycle progression, cell motility, and morphology through its multiple scaffolding domains. The AKAP12 also acts in the suppression of oncogenic proliferation and chemotaxis. The up-regulation of AKAP12 causes cell flattening, reorganization of the actin cytoskeleton, and the production of focal adhesion structures. No previous studies have evaluated the role of AKAP12 expression in UC patients. The aim was to determine the gene expression of AKAP12 in patients with UC and to evaluate its association with clinical outcomes.

Methods

We included a total of 80 patients with confirmed diagnosis of UC and 30 controls without endoscopic and histological of any inflammation. The relative quantification of the gene expression was performed by real time PCR for AKAP12: forward: 5'- ccgctaagctgatctcctgt 3' and reverse 3'- catcttcagagtctctctgtccaa 5' and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH): reverese 3'-agccacatcgctcagacac and forward 5'-gcccaatacgaccaaatcc, a housekeeping gene was analyzed for normalization. Statistical analysis was performed using the program SPSS ver. 17. A statistical significance was considered as P value <0.05.

Results

The extent of disease was evaluated using total colonoscopy, and biopsies were taken from rectum segments. The Montreal classification was used to define the extent of UC: 36.6% had pancolitis (E3); 33% had left-sided colitis (E2); and 39.4% had proctitis (E1). The AKAP12 gene expression was significant increased in the colonic mucosa from patients with active UC as compared with UC in remission and the control group (P=.01 and P=0.03 respectively). The up-regulation of AKAP12 was associated with the presence of pancolitis in patients with UC (P= 0.04, OR=12, 95% CI: 1.29-18.37).

Conclusion

The up-regulation of AKAP12 gene was found in patients with active UC and this gene was associated with pancolitis in UC. This is the first report about the role of AKAP12 in patients with UC suggesting that AKAP12 might play a role as molecular marker of disease extent.