Search in the Abstract Database

Abstracts Search 2017

* = Presenting author

P164 FOX04 gene expression in colonic mucosa is a potential marker associated with histological remission in patients with ulcerative colitis

Yamamoto-Furusho J., Iturriaga-Goyon E., Fonseca-Camarillo G.

IBD Clinic, Instituto Nacional de Ciencias Medicas y Nutricion, Gastroenterology, Mexico, Mexico

Background

Ulcerative colitis (UC) is a chronic and inflammatory disease that affects the colon of unknown etiology. The genetics factors play an important role in the pathogenesis of UC. FOX04 is a transcription factor that regulates the immune response by inhibition of nuclear factor kappa B (NF-kB). The NF-kB regulates the expression of pro-inflammatory cytokines and proteins from tight junctions such as occludins. The aim of this study was to measure the gene expression of FOX04 in patients with UC and normal controls as well as to determine their association with clinical outcomes.

Methods

We included a total of 37 patients with confirmed diagnosis of UC and 20 controls without endoscopic evidence of any type of colitis or neoplasia. All colonic biopsies were taken by colonoscopy. The histological remission was defined according Riley and Geboes index. The relative quantification of the gene expression was performed by real time PCR for FOX04: forward: cgagggactggacttcaact; reverse: ggctcaagggtaaagagtagatatga and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH): reverse 3'-agccacatcgctcagacac and forward 5'-gcccaatacgaccaaatcc, as housekeeping gene was analyzed for normalization. Statistical analysis was performed using the program SPSS Ver. 17.Statistical significance was considered when P value was <0.05.

Results

Of the 37 patients with UC (17 male and 20 female) with a mean age at diagnosis of 42 years and 20 normal control individuals with a mean age of 44 years. Regarding to the UC group, 22 had histological activity and the remaining 15 UC patients were on histological remission. The extent of UC was pancolitis (74%), distal colitis (23%) and left side colitis (3%) and clinical course was distributed as follows: 37% were initially active and then inactive; 30% had intermittent activity and 33% had continuous activity. The gene expression of FOX04 was increased in patients with remission UC compared to active UC patients (p<0.002) and normal control group (p<0.001). No significant differences were found between patients with active UC and normal controls. The overexpression of FOX04 gene was associated significantly with histological remission (p<0.05, OR=8.5, 95% CI: 0.83–87.8).

Conclusion

The gene expression of FOX04 in colonic mucosa was increased in patients with remission UC. FOX04 could be a potential marker of histological remission and its over-expression in remission UC might suggest an anti-inflammatory mechanism as inhibitor of the production of NF kappa B.